Cross-species protein sequence and gene structure prediction with fine-tuned Webscipio 2.0 and Scipio.

BACKGROUNDObtaining transcript homologs closely related organisms and take reconstructed exon-intron gene pattern is a very important process for the analysis of protein family evolution and comparative analysis of the exon-intron structure of particular genes of various types. Due to ever-increasing speed of genome sequencing, genome explanation gap to develop.

Thus, the correct tools for the prediction and reconstruction of genes in related organisms become more and more important. Scipio tool, which can also be used through a graphical interface WebScipio, perform processing significant hit from the output of the program Blat into account sequencing errors, missing sequence and genome assemblies fragmented. However, Scipio so far been restricted to high sequence similarity and can reconstruct short exons.

RESULTSScipio and WebScipio has fundamentally been extended to better reconstruct the very short exons and intron splice sites and would be better suited for cross-species gene structure prediction. Needleman-Wunsch algorithm has been implemented to look for short portions of the query sequence that is not recognized by the Blat.

The regions may be short exons, a different sequence in the intron splice sites, or exon very different. We have demonstrated the benefit and use of the new parameters with a few examples of the protein family of proteins that are completely different in the search for the species from several kingdoms of eukaryotes. Performance Scipio new version has been tested in comparison with some kind tools.

CONCLUSIONSWith new version of Scipio exon very short, terminal and internal, even just one amino acid can be completely reconstructed. Scipio was also able to correctly predict almost all cross-species gene searches even if the ancestors of separate species more than 100 Myr ago and if the identity of the protein sequences under 80%. For our test case Scipio surpasses all other software we tested.

A4GNT Antibody

1-CSB-PA001009LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

A4GNT Antibody

1-CSB-PA072731
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

A4GNT Antibody

1-CSB-PA703896
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

A4GNT Antibody

CSB-PA797885-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

A4GNT Antibody

CSB-PA797885-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

A4GNT Antibody

DF3762 200ul
EUR 304
Description: A4GNT Antibody detects endogenous levels of total A4GNT.

A4GNT antibody

70R-36130 100 ug
EUR 349
Description: Rabbit polyclonal A4GNT antibody

A4GNT antibody

70R-50979 100 ul
EUR 244
Description: Purified Polyclonal A4GNT antibody

A4GNT antibody

70R-7408 50 ug
EUR 467
Description: Rabbit polyclonal A4GNT antibody raised against the N terminal of A4GNT

A4GNT antibody

70R-7409 50 ug
EUR 467
Description: Rabbit polyclonal A4GNT antibody raised against the C terminal of A4GNT

A4GNT antibody

70R-34020 100 ug
EUR 327
Description: Rabbit polyclonal A4GNT antibody

A4GNT Antibody

1-CSB-PA020263
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

A4GNT siRNA

20-abx906234
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

A4GNT Antibody

ABD3762 100 ug
EUR 438

A4GNT Rabbit pAb

A12366-100ul 100 ul
EUR 308

A4GNT Rabbit pAb

A12366-200ul 200 ul
EUR 459

A4GNT Rabbit pAb

A12366-20ul 20 ul
EUR 183

A4GNT Rabbit pAb

A12366-50ul 50 ul
EUR 223

A4GNT Blocking Peptide

33R-5167 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of A4GNT antibody, catalog no. 70R-7408

A4GNT Blocking Peptide

33R-6732 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of A4GNT antibody, catalog no. 70R-7409

A4GNT Blocking Peptide

DF3762-BP 1mg
EUR 195

A4GNT Blocking Peptide

20-abx063854
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Polyclonal A4GNT Antibody

APG01408G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human A4GNT . This antibody is tested and proven to work in the following applications:

A4GNT Conjugated Antibody

C34406 100ul
EUR 397

A4GNT cloning plasmid

CSB-CL001009HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1023
  • Sequence: ATGCGGAAGGAGCTCCAGCTCTCCCTGTCAGTCACCTTGCTGCTTGTCTGTGGCTTCCTCTACCAGTTCACCCTGAAGTCCAGCTGCCTCTTCTGCTTGCCTTCTTTCAAGTCCCACCAGGGGCTGGAAGCCCTCCTGAGCCACAGACGTGGCATTGTGTTTCTAGAGACCTCAG
  • Show more
Description: A cloning plasmid for the A4GNT gene.

A4GNT Polyclonal Antibody

A62026 100 µg
EUR 570.55
Description: fast delivery possible

anti- A4GNT antibody

FNab00015 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: alpha-1,4-N-acetylglucosaminyltransferase
  • Uniprot ID: Q9UNA3
  • Gene ID: 51146
  • Research Area: Metabolism
Description: Antibody raised against A4GNT

Anti-A4GNT antibody

PAab00015 100 ug
EUR 355

Anti-A4GNT antibody

STJ114244 100 µl
EUR 277
Description: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of N-acetylglucosamine (GlcNAc) to core 2 branched O-glycans. It forms a unique glycan, GlcNAcalpha1-->4Galbeta-->R and is largely associated with the Golgi apparatus membrane.

A4GNT Antibody, HRP conjugated

1-CSB-PA001009LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

A4GNT Antibody, FITC conjugated

1-CSB-PA001009LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

A4GNT Antibody, Biotin conjugated

1-CSB-PA001009LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

A4GNT ELISA KIT|Human

EF007514 96 Tests
EUR 689

Human A4GNT shRNA Plasmid

20-abx959561
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

A4GNT Recombinant Protein (Human)

RP036352 100 ug Ask for price

A4GNT Recombinant Protein (Mouse)

RP113024 100 ug Ask for price

Anti-A4GNT / alpha4GNT antibody

STJ72083 100 µg
EUR 359

A4GNT Polyclonal Antibody, HRP Conjugated

A62027 100 µg
EUR 570.55
Description: reagents widely cited

A4GNT Polyclonal Antibody, FITC Conjugated

A62028 100 µg
EUR 570.55
Description: Ask the seller for details

A4GNT Polyclonal Antibody, Biotin Conjugated

A62029 100 µg
EUR 570.55
Description: The best epigenetics products

A4GNT ORF Vector (Human) (pORF)

ORF012118 1.0 ug DNA
EUR 354

A4gnt ORF Vector (Mouse) (pORF)

ORF037676 1.0 ug DNA
EUR 506

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx008159
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx210468
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx210469
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx125472
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

abx037237-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx014174
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

abx330783-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx324703
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

abx430472-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

abx230015-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody

20-abx302945
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyclonal Goat Anti-A4GNT / alpha4GNT Antibody

AMM04849G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-A4GNT / alpha4GNT . This antibody is tested and proven to work in the following applications:

A4GNT sgRNA CRISPR Lentivector set (Human)

K0014201 3 x 1.0 ug
EUR 339

A4gnt sgRNA CRISPR Lentivector set (Mouse)

K4191601 3 x 1.0 ug
EUR 339

Human Alpha- 1,4- N- acetylglucosaminyltransferase, A4GNT ELISA

ELI-12236h 96 Tests
EUR 824

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody (HRP)

20-abx302946
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody (FITC)

20-abx302947
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody (Biotin)

20-abx302948
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

A4GNT sgRNA CRISPR Lentivector (Human) (Target 1)

K0014202 1.0 ug DNA
EUR 154

A4GNT sgRNA CRISPR Lentivector (Human) (Target 2)

K0014203 1.0 ug DNA
EUR 154

A4GNT sgRNA CRISPR Lentivector (Human) (Target 3)

K0014204 1.0 ug DNA
EUR 154

A4gnt sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4191602 1.0 ug DNA
EUR 154

A4gnt sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4191603 1.0 ug DNA
EUR 154

A4gnt sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4191604 1.0 ug DNA
EUR 154

A4GNT Protein Vector (Mouse) (pPB-C-His)

PV150702 500 ng
EUR 603

A4GNT Protein Vector (Mouse) (pPB-N-His)

PV150703 500 ng
EUR 603

A4GNT Protein Vector (Mouse) (pPM-C-HA)

PV150704 500 ng
EUR 603

A4GNT Protein Vector (Mouse) (pPM-C-His)

PV150705 500 ng
EUR 603

A4GNT Protein Vector (Human) (pPB-His-MBP)

PV318522 500 ng
EUR 481

A4GNT Protein Vector (Human) (pPB-His-GST)

PV318523 500 ng
EUR 481

A4GNT Protein Vector (Human) (pPB-C-His)

PV048469 500 ng
EUR 481

A4GNT Protein Vector (Human) (pPB-N-His)

PV048470 500 ng
EUR 481

A4GNT Protein Vector (Human) (pPM-C-HA)

PV048471 500 ng
EUR 481

A4GNT Protein Vector (Human) (pPM-C-His)

PV048472 500 ng
EUR 481

A4gnt 3'UTR Luciferase Stable Cell Line

TU101066 1.0 ml Ask for price

A4gnt 3'UTR GFP Stable Cell Line

TU151066 1.0 ml Ask for price

A4gnt 3'UTR Luciferase Stable Cell Line

TU200010 1.0 ml Ask for price

A4gnt 3'UTR GFP Stable Cell Line

TU250010 1.0 ml Ask for price

A4GNT 3'UTR GFP Stable Cell Line

TU050010 1.0 ml
EUR 1394

A4GNT 3'UTR Luciferase Stable Cell Line

TU000010 1.0 ml
EUR 1394

Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E02A1112-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E02A1112-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E02A1112-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E04A1112-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E04A1112-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E04A1112-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E06A1112-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E06A1112-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E06A1112-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E03A1112-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E03A1112-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E03A1112-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E01A1112-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E01A1112-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E01A1112-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) ELISA kit

E08A1112-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha 1,4 N acetylglucosaminyltransferase(A4GNT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top